EST 880954 is a singleton


Sequence

>880954 (1 EST) Length=254 CAAATTAATGGCGAAAAGGTTGAGTCTGGTGAGCTGGAAGCCGATTGGGACTTTCTTCCTCCGAAGAAGATTAAGGATCC GGACGCAAAGAAACCGGAAGATTGGGATGAGCGAGAATATATTGATGACGAGGATGACAAGAAGCCCGAAGACTGGGACA AGCCGGAACATATTCCTGATCCGGACGCCAAAAAACCGGAAGACTGGGATGATGAAATGGATGGAGAGTGGGAACCACCA ATGGTTGATAATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 880954: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8809541870938AA241568MBL2SJ2F7T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 16:17:30 on Sat 18 Nov 117.