EST 880957 is a singleton


Sequence

>880957 (1 EST) Length=218 CAAAACAATTGCGTTACAACATCGAAATTGATCAGCTGTAGATGACAAAATAACGATTTGCACAGATTATACATATCTTT AAGTTCATGGTTCCTGTTCGTCATGCTGCTGTATATTTGTAAATTGTTACCTCGTCCATCTATATTACATTTTTGTAGAT AAAAAATTCAAAGTTTGTCTTATGATACTTAGTCAAATCGGATAAAATAATTTGCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 880957: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8809571870941AA241571MBL2SJ2F10T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 12:6:18 on Wed 22 Nov 117.