EST 880992 is a singleton


Sequence

>880992 (1 EST) Length=213 GATGTCAGGTGATAATCTGAATGATTTCTACTTGCGTTACTATGTTGGTCATAAAGGGAAGTTCGGTCATGAGTTCTTAG AATTCGCAATCACATACAAACCTGTGAAACATGGACGGCCAGGCATTGGTGCAACACATTCTTCCCGCTTTATTCCCCTC AAGTAATGGAAAATTTATTGTTATGGAGATGACTGATAAATGTTTTGTTTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 880992: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8809921870976AA241710MBL2SJ8C4T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 7:23:35 on Sun 19 Nov 117.