EST 881005 is a singleton


Sequence

>881005 (1 EST) Length=122 CATTGGTGATATCATTGTTATCATTTGAAATATCGTCTTCAGTGGTCATTTTTGTCGCAGTTTTAGGTAATTTTTCATTT CATTTTTTGCTTCAGCTTGTCCACTTTTCATGGTCATTCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 881005: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8810051870989AA241580MBL2SJ8D5T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 18:19:15 on Fri 17 Nov 117.