EST 881020 is a singleton


Sequence

>881020 (1 EST) Length=372 GGAGGAAAATTTAAATGCCGAAACAAGAATTTGAATTTATCGATTATCTTGGACCATTAGCTGTATCTGTATGTTTTGTT ATAGCACTATTTATTTTATCAGCTATTATTAATTTCATTTGGATAACAAAAAATGACGATCGAACAGTTTTTGAAAAATT TGGCTCAACGTTTGATCTTCGATGTGGTGTGCATCGAATGCGGCATAGGCCAAATAAGTCATGGAAACGAGTTCAGTTAA TTGATAATCAAGATGTATAAAGAAACAATCCTCAACTATTTCTGAGATGAGGAATGAATTATCATCCGGTAGCTATAAAG CCAGAAATGATAGTACCTCAATTAATATATGATATGATTATAGATTAATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 881020: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8810201871004AA241699MBL2SJ8E9T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 8:16:51 on Thu 23 Nov 117.