EST 881034 is a singleton


Sequence

>881034 (1 EST) Length=219 GAACCAGCAAGTCCTTCCGCTAATCATTACTTATTGTTTATTGTTTTGAGTTTTTGCAAACTGAACTCAATAAAAACAGA TGCAAATGGAGATGTTCTGAAAGGGATGGAAAATACTAATTATCCGGAAAACAAGCATTATTTTCCAGATATACCCAAAA TAAGTGAAAAAATGGAAAGCGCTCTGGAAGTGTTCGGCAGGCAGCATGTCGGTTTGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 881034: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8810341871018AA241726MBL2SJ8G1T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 1:22:8 on Mon 20 Nov 117.