EST 881067 is a singleton


Sequence

>881067 (1 EST) Length=238 ATACTCAAGACTTTTGCGACAAGTGCTGTAACGACTACCACAATGATGACTGATGTACGGTCTCCAGCTGATAGTCCCTC AAGACATATTACTGTTGTTGATGTCTACGATTTGGCTGCTTCAATCGGTAAAGATTTTGAACGAATCATTGATGAGTTTG GCAATGATAGCGTGCGACAAATTATGCCAAAGGTAATATCAGCTCTCGAAACACTCGAATCACTTGCTAATCATAACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 881067: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8810671871051AA241452MBL2SJ9B8T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 23:21:25 on Sun 19 Nov 117.