EST 881069 is a singleton


Sequence

>881069 (1 EST) Length=430 AAAAAATCAAATGCTGATCCAGATGACAAGGATACAATCTATGAAAAGGCTAAAGCATACTGGGCATCCGTATCTTGTAA TGTAGACGGTATGCTTGGAGGCTTCGCTCATCTGCATGTACCCGACATTCATGCTTCAAAACAATTTATTAATCTGTTGA AAGCTAAAGGAACGCTGACAAAATTTGAACGAGCTGTTGACTGTGGTTGTGGCATAGGACGTGTTACCAAGCATCTCTTA TTACCATTATTTGAATCAGTGGATATGGTAAATGTTACCGAAAGTTTTATTCAAGAATCTGCCAACTACATTGGTAAAGA GAACAGTAGAATTGGTAATAAATTGGTATGCAGTTTGCAACAATTCGAACCATTATCTTGTCATTATGATCTTATATGGA TACAATGGGTTACTGGTCATCTGACTGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 881069: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8810691871053AA241527MBL2SJ9B10T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 2:50:38 on Mon 20 Nov 117.