EST 881072 is a singleton


Sequence

>881072 (1 EST) Length=154 AATGACTACATTTGATGTTGAAAATGAAAGATTAATGGATAGAAGTGCAATAATTAATAATGATTTATTGAAGAAGAGAA AAATATTGAGAAGTATTCAAATTAGGATGAATTCCGGGTATAATTACCCAAGTTTGAGGATTTCGACGAGAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 881072: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8810721871056AA241530MBL2SJ9C1T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 1:53:14 on Sat 18 Nov 117.