EST 881079 is a singleton


Sequence

>881079 (1 EST) Length=214 CATAAGCTATTATTTTGCGCGCTATTGGGCGTGACATTTGCCGCCCAAATGCGACCACAAGCTGAATAACTGGAATACCC ATAGTTCACATTAATCTTCTTCTGCTGAATCTTCTTCTTGCCAGCAGTGATTGCTCCATCATCTGCATACCATTCCGCCC ATGAATTTCTTCTTATTAAATACCGCCGAATTCGATATCAAGCTTATCGATACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 881079: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8810791871063AA241537MBL2SJ9C10T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 9:55:38 on Fri 24 Nov 117.