EST 881081 is a singleton


Sequence

>881081 (1 EST) Length=71 GATTGGCTAATCTGTGACGAAAAAATTTTGCAATTATTGCAAATTTTTATCTCAACAATAAATAATAAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 881081: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8810811871065AA241539MBL2SJ9C12T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 12:46:40 on Fri 17 Nov 117.