EST 881085 is a singleton


Sequence

>881085 (1 EST) Length=377 CACGCGCAAATTGTTCAATGGAGTCATTAGATATGCAACGACGGAAGAATATGCTATTAGCAACAAAAGCAACATTAGCC GAATTGAAAGAATTATTAAGCAATGATCGAAGTCCAATATGTTCCTCAAGGCCACAACCAATTTTAGAACCAATTGTGCA AAGTCGACTAACACATTTCTCAATGGTTACCCATGGATTCGGTTCACCTGCTATATTAGCTGCAATTAATGCAATTATGA ATTGGTTGAATGAATCGGTGAAATTGCTTGATGCGAAATGACACATATTTTAAAGTATCAGAAATAATTACGGATGTGTG AATTTGGTGATAATATTGTAATTATGTTATGCATTTTTATATGTTAATAAGAAATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 881085: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8810851871069AA241686MBL2SJ9D4T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 14:25:32 on Fri 17 Nov 117.