EST 881102 is a singleton


Sequence

>881102 (1 EST) Length=437 AATAATTTATATAAATTAAATATACTAATTTTATCATAATTTATAAATTATTATCATTAAAATTTATATTTTAATAAATA ATTTAATTTAACAATAAATAATAAAAATTTTAAAATAAATTATAACAAATTTATTAATGATAACTATTTTTAAGCTTACA TTTATTAAATATTTTATTAAAAATTTAAAAATTTATTTTAAAGCTAATCCCTTAAAATATTAATTTTATAAAATAAAAAT ACTATATAAATAGAACTTTTAATTTATAAATCTAAATTAAATTTATTTCCTAAAAAACTAGATATATTTTAAAACGATTA ACATTTCATTTCTAATTATATGTTTAAAATAATTATTCCACAGTAACTTTTATATATAATTAAATCTTTAAAATTCGAGA AAAATTAATATAATAATTAATTAATTAATAAACCCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 881102: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8811021871086AA241422MBL2SJ9E11T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 19:7:23 on Sun 19 Nov 117.