EST 881134 is a singleton


Sequence

>881134 (1 EST) Length=340 TANAATGATTTTGGTGAAAAGTTTGACTGCGATGGCAACAGAAAAATTACTGTTGAAAACATCAGGTCAGCAATTCTTGG ATGGCGTCGATTATATGTATCGAGTGGGTTTATCACCGGATCGCTTATCAGTTATGGAAACGACCAGTGGTAAATTCATC TTACAGTTCCACTCACGATGCGATCTTCGTCCATTCGCTGTATGAATATTTCACTGAACTTATTGGTTACTTCAAACTCG CGTGTTTTTTTCGAGGAAGGATAATATCAAGAGTTATCATTTGTTGCTGTTGCTGCTTAAATCTATATATTTTTCCGTTT TCGAGTAAACTAGTTCTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 881134: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8811341871118AA241454MBL2SJ9H10T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 20:41:42 on Tue 21 Nov 117.