EST 885460 is a singleton


Sequence

>885460 (1 EST) Length=580 AATAATTAATCACATACCTTTTAATACCTGGTTTAAAAGAGTTTTATGAATGCTTAAAGGTGAAACACCTTGCTGAAACA CCTTTCCATAATGTCATTTTGTTTGTCATTCTTCATAGCAGACGATAACATTGACTATCGATAGTGCATGCCATCGTCTA AATCAAAATTCACCATCATCATCATCAGCAACACTTTACCAAATACCGTACAGAGAAAAGAAGAGAGGTTAAGGAGGAAA CAATGCATTTGAAGATTGTTATGCAAAGAGACAAACAAAAAAGATACTACTGCTTGTTTGTTAACTTTTAAATTTGTTGT TAGGAGTAAATGACGTATGTATGCCATAAGAGGAAGAAAAGAAAAGAAAGCATTTGATGTGATCGTCTTACCGTGTGATC ATCTCTTACCGGATTAACTGGAATCGGATCGAATCGGATCGGATCGGATCGGATCGGTGGTGACAATTATAGCTGTGACA AATATGCGTGGTGGTATTGACAGGTGACGATGGTAGGAAAAGGAGGAAGAAAAGGACCAGGCTGCGTGGTTAATGTTTGT CGGCAATGTCCCATTTTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 885460: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8854601876864AA246043SWMFCA1162SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:57:11 on Tue 21 Nov 117.