EST 885486 is a singleton


Sequence

>885486 (1 EST) Length=576 GAGATTCGTTGCTGAAGGATATCATTGTTTTTAAGCAAGTTTGATATTTTGAAACAACATGGAGCAGCGCAATATCACCA CTCAAAAAATAATATTTTTGGGGGCAGTTCGAGTTGGTAAAAGTACGATCGTGAAAATATTGACTCGAAAGTTCAATTTT AATAGTAAGGATTATCAAATGGTAGGATCTAAACAGCAAAATTATCTGGTCTCACAGCTATACTGCAAAGAAAAACTGAT ATTGAAGAAGTTCGAGGCAAACTTGAAAGCTAAAGACTAAAACTCAAGGTGTGGAACTGCATGATAAGGCATTAGAGGTT TGTGGACATACAGTGGATACAGTACTGGTAGATACTGCTGGCCATGAACTTTATAAATGGGTTGTCAAACCCGTATGCGA TGAAAGTGCTTTTTGTGCACTCTGTTTTGATCTTACCAATAAAGATACCTTAGTATTCTGAAGGCATATCTTGAAGAACT GAGCATCCAAAAAATGTCCTGATCGGCTGCCAATTTGATTTACAATCAAGACTGCCATTTCACTGTCACTGCTGAAGAAT CCCTATAAATAACAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 885486: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8854861876890AA246056SWMFCA1221SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 11:52:29 on Fri 24 Nov 117.