EST 885502 is a singleton


Sequence

>885502 (1 EST) Length=809 AATGATTCAACAGAAGTCCTTCTTGGTTCTCTGATCCAAATTAAAAAGATATATCCTCAGATTTTTTCAAGTAATCCACC ATTCGAGTTGAGAAGATTATCGTTTGCAGATGTTATTTCGGCAGGTGTAAAGTTTTATTCGTTTTTCTAATTGATATTAT AGGTTGCGTTTTCTTTGGTTTTTCAGTTTCAGATAGTCCAAATGTAAGTACTTAGCTCCACAATGTATTGAATTGTAATT TTAAGGTGTTAAAATATTAACTACAGATGATATTCGAAATGATTTGTATGTTACATTGCTACAAGGTGATTTACATGGTG GTAAAGGGTCCGACAAAAATATTGAAGTACGAATAACAGTCGTTGATGCAAAAGGAATAGTTGAAAATAGTATCGTTGTG ATCACTGCAGACGGGATACGTTGGAGCACAACATACCAAAGTCTGGTTTTTTATCATGATGACAAACCAAAGTGGAACGA ATCTATCAAAGTACAGATTCCGGAGAATATTGACCAAAATATACATCTTCGAATGACTTTTCATCACAAAAAGACATCTG ATAAAACTAAGCCAGAAAAAGGACCTTCGCATTGTCATCGTAAAGTGCTGCGTGACAATATTCCAGGAATAACAAAGCCA CTATCCACGTTGGGCACGACTGGGTGGTGTGAAACGTATTCGGGATGAATTATGAAGAAACACTTGGCGTTTTGAAAGTG TTTGGGAAATGTCATACGTTACGCTGTACATATTGTGAGCACCCAAACGAAAGAAGTTACGCATGGAGTGTCAGCGTTGA ACCCAGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 885502: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8855021876906AA246098SWMFCA1556SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:4:43 on Tue 21 Nov 117.