EST 885505 is a singleton


Sequence

>885505 (1 EST) Length=579 GTTTTATTTTAATAAATTTGGATGATGAATCCGGATACGAACTATATACGATTGCGTGGACTTCCGTTTGCCGCTAAAGA GCAAGATGTTCGAGACTTTCTCCAAGGTTTGAATGCAAAGTCGATAACTTTCACGCTGACATCCAATGGTCGGGCAAGTG GAGAGTGTTATGTGGAGCTCGATGATCAGGAAGCTGTTAAAGAAGCTCAAAAACTTGATCGTAATGAAATAAATGGACGC TACATTGAAGTATTCAGCGTTAGTGATGCGGAGTTATTAATGATGATACGTCATGGTGTGATCAAAAGTAGTGGTGGTGG AGATGCGGACAGTCGCTATGCTAGCAACTTCGTTGTCCGTCTTCGGGGTCTCCCATATAGTGCAACGATCGATGACATCA AGGAATTTTTTCAGGCCTGGAAGTAACGGATGCGGTAATCGACAAAGAACCGGGGGGTCGACCTTCAGGGGAAGCATTCG TACGGTTGGCAACCCAAGAATACGCCGAATTGGCTTTGGAAAGAAACAAAACTACCTNGGTTCCAAGNATGTTCAAGGTT TNCCGTATTCCGGCGAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 885505: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8855051876909AA246101SWMFCA1559SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:44:19 on Sat 25 Nov 117.