EST 885509 is a singleton


Sequence

>885509 (1 EST) Length=593 GAAAAGAACATTGAATACTGAACCATTTGTCGAACCATTACAACCATCTCGCTTTCACAAAAAGACGGTTCTTGATATCG TTGCAAATCAGTAATGAGGATCCGTAAGTACTCGTTTGCTGTCAATTAATGGTAATGCTCAGAACAGGTTTATCTATGCA TTTGTTTCCGTTACAACGGCATTAGTACTGTCACGCTGAAAACAGCATTAGTTAAATGTTATACGGATGGTTCACTCTTG ACATGTTTTTTTTGATCGATTTGATTGATGTTGAAATTCATAAACATAGAATATTAGTTACTTGAAAATTGGTAGAATTT AGCGCATATCCATGGTTACTGGATTACATTAATCGAAACAGCGCACGTCAAACTCGGCAAATATCGGTGCATACTTTAAT TAGCCAAGCAGAAAGTGGGCGAACTATTACGAATTTTACGTATTTACCAGGACATGGAATGCATTATTCACATATAATTA TCGATGGGATACAGGTAGAAAGGCACGAGAAAAGCAGTTATNCCGAAAGGAATTATCGCACACCTTTTGAAACTGTCACA TNACAACTTTAGTACTGGANGTTCGGTTTTACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 885509: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8855091876913AA246105SWMFCA1563SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:32:17 on Fri 24 Nov 117.