EST 885537 is a singleton


Sequence

>885537 (1 EST) Length=241 ATCAATCTTATCGATTCCGTCGACCTCGATGGGGGGCCGAGTACCCTCTCCGGACTATATTGATTCATATTATAAGAACT AGGCTCCTAGGCTAATATTGCCAATTTTCCCATACGTTACCTTACTTGGTTGCATAGGGTGGCCAACAACTTTACCTTAA AAATATTACAATGCTCTTGCGGGCTATTGCCTTGATACCCCTTGCCTGGAATTAATCAACTACGGACCCCGTCCCACCCG T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 885537: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8855371876941AA246133SWMFCA1610SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:37:52 on Fri 24 Nov 117.