EST 885564 is a singleton


Sequence

>885564 (1 EST) Length=628 TCGAAGGCTATCACTCATATTTGGGAATTTTGAAAAATGAGAAAAATCTTTCACTTTTTGCTACTTTCTACCCTTTGTTT ATTTCCTATAGAAGGAGAAAAAAAATGATGACAGTTACGATGAAACTTGCAAAAGTTTGGGTATTATGATGGATATTTCT AAGCCAATAACTGATTCAATAACAAAAAATTTTGCTACTTTCAAGAACAGCGATTTGTTATCTATGCGCAATGTTTGCAA ATACTTTCGAAAGAGTGCAAACGAAGTGTTGAATGAACGGATTAAACCTTTGGTCATCGTAAATGGTACAATAAGAAATG CAGCTAATCAGAAGATCTTTTCACTTTATAAACAGCAACTAAATACTATCTCTGCTAGCGACGATGAATTTAAAAATTTT TCAATGCTTCAAAAATGGCATGCTGAAAATGGTTTATTATTTGATGATTATAATGATCTCCCACCACTAAAACGTTGACT ATCTGGGCCAATGTTTTTGAAGGATGGCACCATTTGGCAATAGTATGATAATTGATCCTGAACTATCCCTTTATTCAGGT TGTTAATTAAGCCATGGTCATCCCCGAAGTGCTATAATTTTCCCAAAATGCCCCTGCTTCTATAACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 885564: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8855641876968AA246160SWMFCA1643SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:57:1 on Fri 17 Nov 117.