EST 885582 is a singleton


Sequence

>885582 (1 EST) Length=619 AATTATCGTTANCGCCAGACGTCTAGGGGGGGCTANNNCCTGATTGTTCCTACTGTNAATCTTAAANTATCTAAATGATA CGTAAGAAACTCGACGCTATACTTAGACTTCTATAGTCTTTCTTTTCTGAATGACAACAATGTAAGAGAAGTAGTTNAAT TCAGACAGCGAAGTTGTTTNAAACAACTTATTTGACATACTTCAAGGAGANGCNAGAGTAATATAATTATGTTGAGGCAA GAAAATACAATCGGTGTGGTGTTGGTTTATATCATCGTATTTGTGCGTTGTGTTTGTATTTATCAACTAATTTTTTTTTA AAAAAAAAGAAAAATTTATCGCTGTAACNCCATATNNCCTCTGCTTTACACATGCTACCGAGGCATTTGCATCGATGCAT TATGAGCAAACCCACGGTTGGGAATCAATGGGTCAGCTGGTCATAATCTATTCACTCATATTTAAATTAAATACTATAAA GCTGATTTTGGAAGAATTGAAATTTTCCTTAATTTAAAAACCCCCGAACTTGCCAGTCTTTGTTGAAATTCTTCTCCAAT TCAAATTGGTCGTCCCGTCACCTGTCCTGAAAACGGGATTGAACGAATCCGTTGAAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 885582: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8855821876986AA246074SWMFCA1666SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 10:42:32 on Mon 20 Nov 117.