EST 885583 is a singleton


Sequence

>885583 (1 EST) Length=452 CATCTTTCCGCGCCGTCACCATGGTGCGCATGAATGTCCTGGCGGATGCTCTCAAGAGTATCAACAATGCTGAGAAGAGA GGCAAACGCCAGGTCCTCATCAGGCCATGCTCCAAAGTCATCGTTCGGTTCCTCACTGTGATGATGAAGCACGGTTACAT TGGTGAATTTGAGATCATTGATGATCACAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGTTGAACAAGTGTGGAG TGATCAGCCCTAGATTTGATGTTGCAACTCAAAGACCTAGAAAAATGGCAGAACAATCTGCTCCCATCCCGTCAGTTTGG TTTCATTGTACTGACAACCTCAGCTGGCATCATGGACCATGAAGAAAGCAAGACGAAAACACACAGGAAGGGAAATCCTG GGATTTTTTTCCTAGAGATGTTTAAGCATAAATAAAAACCTCTGTTGGACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 885583: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8855831876987AA246075SWMFCA1667SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:28:54 on Mon 20 Nov 117.