EST 885589 is a singleton


Sequence

>885589 (1 EST) Length=617 AGAAACAAAGTTTGACTAGACTCCCAATCTGCAAGCATTGTGAGGTTTATTGTGAAATTATCTTGATTTCCATGTGTGTT GTATTTTCTGGAGTTTGTAAAGCTCCAAATAATTTCTATTTTTATAAAATTATTGTATGTTTAGTCTGTCTCAGAAGTAA TTTTGCAACATATGGAAAAGAGTAGCTGATATTTCTAAATTGTGACCATGAGCCAAGATTGCTTTGAGAAGTGCTAGTGT TATTTTGTGTTTGGAGGCAGCCATCATGCTGAAGGCCCATTCACTGCATAGCACTGGACACGTTGTGCACATTCTGGCCA TTGGTGTGCTGCACTAACCAGGTTTTCAGATGTGGGGAACCAGCAGGCTAAAAGTCGTCATTCATTTTTTTCAGAGCTCA CTCCTCCTCCCCCTCTGTCTCTGTCTGTTTCTCTCCCCTCTGCCCTCCCTCCCTCTCTCCTTCCCTTTTCAGATTTCCTA CATATGTTCCTGGGGTTTGAATCCATTAACTTGTTAATGGAAAATCAATGGTGTTTCACTAAGTTGGTACAGTACTAATT TTCCTTGACTTTCAGTTTTTGAAAGTACATGAACTATATACCCCCCCAAAAGAAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 885589: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8855891876993AA246081SWMFCA1675SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:21:31 on Mon 20 Nov 117.