EST 885599 is a singleton


Sequence

>885599 (1 EST) Length=610 GAATATCGATCCTCTCCACCTCAAGGGGGGGTGAGCGCTATCCAATTCATTCTATAGTGCAGTCGCATCCAAGCCAATAA ATTCTCTAAAAATATTTTGGTGCCACGAGCCGGGAATGTCAACCATTATAATCGAAGCGCACAAGCGGTAAAAGAAAAAT TGCAATTTCTTCTCAAAGATGTCGAAGGGATGGATCTAACACCATCGGATCAAATGCTGACCAGAAAAGAAACCTGTCAG CAGCGAGGCCAGAAAAAGAATTATTGAGGAGTAATTAATGCGTCTGGAGCTATATCTACTAGCAAAATCGCTCATGCAAG ATGGGCAAAATATATCCAACATGTCCCGACTTCATTAANAAAAAGAGCAAGAAGGAGAAAATATACACAGTTGGTCGAGG ACAAAAAAGGTATTTCAAACGTTATAAATGAAAGATAAAGAAATCAGTATAACTTTAACTATGTTCAAAATAACTCTGAA TTAGTAATCGCCAGGCCTCCCTCTCGACTAACTAAGGATGAATCACTGGATCTAGACATTCACCCCTTTGACTTATTTCC CCCGGTTATTTTCCCCCCCTTTGCCCAATTCATGGCATTCCAAACCCTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 885599: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8855991877003AA246182SWMFCA1691SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 18:26:8 on Sat 18 Nov 117.