EST 885602 is a singleton


Sequence

>885602 (1 EST) Length=605 ACTAATTCGTGACGCGCATGAATGGATTAACGAGATTCCCACTGTCCCTATCTACTATCTAGCGAAACCACAGCCAAGGG AACGGGCTTGGCAAACACAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTCCGACTCTGTGAAGAGTCATGAGAG GTGTAGCATAAGTGGGAGGTTTTTTTTGTATTTATTATACAAATACCAACAGTGAAATACCACTACTTTCATCGATTCTT TACTTATTCGGTAAAACGAGAATTGAAATATTATATGTATTTCGAAATTTTTGATTTAAGTTAAATCACTCGGTGATTTA ACGACTCGCACCGAAGACAGCTTCGGTATCCGATTGGATGTTAGCCATTTCCGACCAGAAGAATTGTCGGTGAAGATGCA GGATGGGAGACTGTTTGTTGAAGGACCCCCGAAGAACGAAATGATCACATGGTCCGTGGAACGACATTCCTCCGGAAGTT CCCTATTCCAAAAACCGTATTGCAAGAAATTTGGATCCCGTTGTCCAACAGGTGTTCTCCCAATTACTGCTAAAAAAAAC TGTCAAATCCCCCGTTTACAATATCCCATTCATTCCATCCAAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 885602: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8856021877006AA246185SWMFCA1697SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:12:42 on Thu 23 Nov 117.