EST 885608 is a singleton


Sequence

>885608 (1 EST) Length=726 GACTATACCATCTGAATGAAAGTGAAGTGAAAAATCATTGAAGAAATTAATGAATCAGAAAAAAGCGAAAAATAATGATA ATAGTTTATTTACAAATTTCAATCAGATGGAACCAGAGACGACTACAGAGAGACATTTCGATGTCAGTAAGAATCAGAAA GTACTGGAATTACAGAGAAGAATTTGCAGTCGAACAAACACCAATAAAGAGATGACACAGCAATATTTGGAAGGAAGGGA AGTTGCTCTGGAGAATCAGCTGTTATTATATAAAATGGATGAGAAAGGAACTGGTTGTGAGTCAGTGCAGAATAAACAAA TTAAAGTGAATGTTGGATGTGGAGTTGCAAATAAAAGAGAAGGATGGAAGGCGGATGAGTCACTGAAAAATTTGGAAGAC AATGTAATTAATTTAATCGAAGCTGAAATCATGTCAATGGGAACGGATATTCAGTGGACGGATATATGTGGTTTGGAGCC GGCAAAAAAAGCACTTAGAGAAATTATCGTTTTTCCGTTTCTCAGACCGTATGATTTTATGTATCTAACTTTTATTTATA CAGTCAGTGCAGTGTCAGTGTTTTATAACCAGTATTAATTTTTGTTTTCTCCACGAAATACCATACTTTGAAATAATCCG TATTAATTTTTGTTATGTTTATTTACATTCAGTTAATAATGATATTAAGAAATGCTGGATAATGTTCCATATCAAAATTA AATTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 885608: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8856081877012AA246191SWMFCA1709SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:59:23 on Fri 24 Nov 117.