EST 885611 is a singleton


Sequence

>885611 (1 EST) Length=510 AAGAAGGAGAAATGTCTCAATTTCGATTTTTTATGCAGTACAGAATTAGTTACGAATTTTTTCAACATAATTTGCTTCGT TCTTAAACTGATTCATAATTTTCATATAAAGGAATTTTAGCGCTTCATTAATTTGGCATAGAATATTAATAATATTTTGT TGGTACATATATCGTACACAATAAACAATGTTTCATTTTCACAAAAAACAATTTTTTGATTTTTAATTGAAAAAAAAAAC TGCAGAATAATAAAATAATTAAATATTTTTTGAATTTTAAAATCTAAAAAAATGTTTTTTGCAGTGTTAATTTATAGCGG TTCATTTTAAAATTTGAAAAAAAAGTTCAGAAATCAATCAATTTTGCAAAGTGTTTGATTCTTTGATATTTTTGACATTT GGATTTTACTATGGTGATTTAATTTAAGAAAAAAAAAATGAAAAATTGGAAAATCCAAACATAAAATGATTTATAATGAA TTCCTCTTTTTTAAATTCATCGAATATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 885611: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8856111877015AA246194SWMFCA1715SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:30:27 on Sat 18 Nov 117.