EST 886508 is a singleton


Sequence

>886508 (1 EST) Length=454 NNGNNGNNCCCGGGGGCTGCNNNGNCTTCGGCCNAGGGCAGCACGCGTAAGCGCAGGAATGATAATTCAGGTAGTTCAGA GAAGTCACGCTCTTTAGGTAGTCGTCGATCCACTTCACCCTCAACTTCGCGTACTCATTCTTCACGTTTTCATCCCACGC ATTTCTCCACTTCTTATGGTGTTGTAAATAACCATCTGAAAAAAAAACACTTCGTGTCAACTTTGAAGAGAAGTCATACA AAGGAGAAAACAGAAGAAAGTCGAAATTCATGCAGCAGACGTAGTTTGCAGAAAAGGATGGGGAAAGAGTTAAACGAAGG AATCGATAGGAAATTATCAACTAGTAATACAAAGGAAGAAAGATTCAAAAGAAATCATTCTGCTCAGCTACAAGATTCAT TTGGTGAATACCTCCGTGGTGATCCATGATAGCAAAGAAAAAACCGAAGGGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 886508: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8865081878420AA247091SW3ICA2192SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:48:38 on Tue 21 Nov 117.