EST 894439 is a singleton


Sequence

>894439 (1 EST) Length=689 GTACTTTTATGATCAGCTTCAAGGGCTTTTTCTTTTAGTAACACACTGTTTTCGACATACATTATCATCCTCTGTCGTAT CTTCATTTGCTTTGAACCTAATTTATCTTATTCTGTTTTATGGTTGGCTCCTGATAAAGGGAACTGATAATAGTAAAGAA GAAACAAAGAACAGTTTATAAACATATAACTCAAGTTTACTAATTTGATGGTTCTCGTCGAATATCTCAATCTTATTGTT TGCTTTTGTGACCTAACTGAACAATAAAAGTGTTAGTGGTACTTGTTGTGGTGTGTGAAATATAGATGCGCGGTATGAAT TTCTCCGTGACGATTTGTTGCTCACATCTCCTCAAGTCCTTCAGTGCTATACCCAGTGATGCTAACCGTTAATCCTAACT TGCAAGACTTTACTACCACTGGCAACCGTGAACTACCAGCCGGAAATGTTNGTTTTCGCTCAATTAGTTGAAGTGTTTGC GTCGAACAATGCTGTTGTAGACGGAATAATCTANAAATTGCGTCTTGTGGGGACTTAATTGCNGCTTGTGAATCCTGTGG GAATGCAGGTTTCAATTGAAGGGATCCTTATGGGTGGTGGGGGTGCGTTGTCTTGAACAATTTATTTTGGGACAGTTTGG GTTGAAATCTGAAAGCCTTAACCCTCCGGAACCCGTATGTTGAAGGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 894439: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8944391887864AA253515SWMFCA1400SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 18:59:59 on Thu 23 Nov 117.