EST 894440 is a singleton


Sequence

>894440 (1 EST) Length=626 GNAAACATGAAAATGTAGCACTCAGTGACTGATTGTGCTGCAGTAGTATTCCAAATCTTCTTTAAGTAATGTTTGTGGGT CGATATTGTAAATCGATGGCTTGTCGAGTGTCATAGAGTGTTGGTGCCTGCAATAAAAAGCATCTTAATATAGACATTTC ATAGCAAATTTGGACCTACGCTTGATTTAGGCCTAATAAACAACATAATTCTATGCAGATCTAAACTTGCAAATTAGTCT GCATTCATTTTATATTGCTTAAAGGGACTAAAAATTGTTACTCTAGGTTTACCTGAAGGAGAATTGTGATGGTTCCTGCA AAACAGGCAATCGATAAAAGTAACAAAAATAACCGATCCAGTACCATTGCAACATACTTCCAGTCTTCGTCCACCTAAAT TGATTTTATTTCAAACGAACAAAACAAATTTCTAAAATGTCGCGGTAATCAATCTTGTACGGTTAACAACTAATGAGAAC TTGAAACCCTCCAATTTTCTGTTTAATTCACTCACTCCAATTGGCTATTCTCAGTTGGTTAGTATAATACAGTGCTTATC CTGACTTATTTATCATGTTGATATTGTTACTCNAAATCACATGAGACCAATTAGGCCTCTAACTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 894440: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8944401887865AA253516SWMFCA1402SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:0:53 on Tue 21 Nov 117.