EST 894444 is a singleton


Sequence

>894444 (1 EST) Length=651 GACTTGTCAGTGGACATACCGCATCCATACGTCCTGACGCACATGCAAAAATTTGCACGAGATGCGTCAGGAAACAGAAG GATATCTGAAATAGCTTATTGGTTTGCGAGTGACATGCTCCATATGACAAATTGGGGAGTACGTTACACGGCGAAAGCGA TTGCATGTGTTTGCATCCAAATGGCATGTCTCTGGGCAGAATTTGAGGTAACTGCTGTATATACAAAGCCAGCAGCGAAA ACACTACCTTGCCGTTACATTTTAAATTTAGAATGTTGAAAAAAAAGAAAATTTAGTTCTTTAACCTCAAAAAAAAGTTA TACAAATTCAAGTGTCTGCTTCGTGTGACTACTTTTNCGTGTGGTTGCATGCGTGGTGCGCAGCGTAACAAATCCGTGAA AAAGCTGTAATGCGTTACTTCCTGCATTTTGCAATTAGTGTTGCGTGTGCGGGAAGTGTTAACGCAGATCAGTTTCGATA AGCACTTGAAAGAAAAAAACTCTTGGACTGTCTCTACTGATTGCTGCAAATCGTGCAAGTTCCATGACGTGTGAAAATAG CGCTGGAGATTTGCACTTCATGTCGAAAAATTGGGAATGGAACGAACTTAAGTGGCTCCACCTTCAATGCTTNGTTGTNT TTTAAAAGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 894444: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8944441887869AA253520SWMFCA1407SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:37:51 on Mon 20 Nov 117.