EST 894446 is a singleton


Sequence

>894446 (1 EST) Length=620 GAGAAATGCAAGTAGTNTATCTTAAATAACTTACTTCGTGCTGTTTACAAGTTCCTGATCNAAATTTTTGACGAGATACT ATTCTCTGCCTGATATTTACCAAACTTCTGCTATGATTATTATCTATCATGATAGATATATCTNTAGCTGCTAACAAAAA TATATCAATTAGGATTGAGCCAAATATATCCATGACTTCATCCAGACAGACGTTGAGTATAAATCTGATACAGGTTTCTC AGGAACTCATCCATTTTCTTTGACTTTTAAATTTCTTTTCAAATGATCTTGTGTCATTCACAGATCGTATCTACGTCGTC GGACGGCCGATTGCAGGTGTCACAGCGTAAATGTTTGCCTCAAGTGATCTATTGTCGACTGTGGCGTTATCCGTAACTTG CTTCGACTCATCGAATGAAATCTGTCCCACATGGTCATGTTCCGTATAGTAAAAGGCTGGAATCAGTTTGTGTCATCCTT AGCAGTATGAAAAAATCGAGAATCACCGATGTTCTAATCTGCAATATCCAACAGACCTCCGGCATCTCACAGAATCAAAC CAATTCTATGCGTTGAATTCTGAAATCGCATCTCCAAATTNTCCCAACCGAGGCGTGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 894446: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8944461887871AA253522SWMFCA1409SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 11:34:10 on Wed 22 Nov 117.