EST 894456 is a singleton


Sequence

>894456 (1 EST) Length=658 GGATGGTAATGATGATGGTAGTGGTGATGAAGATGGTGATGAGGATGATAATGATGATGAGATAATGATTAGTGTCTCTG TATCATTTAGGAGTCTAGACTTGAACCCAGGGCCTTATGCTTACTAGGCAAATACCACCAAGCCTTGTCCCTAGCCCTGC CTTATTGGCTTTAATGTAGCTATACTTTAACAATTAGGTGAATCAGAATTTGATTAATGTAAATCTTCAATGATGTCTTG GAGTTAATCAGGATTATAATTATTATGCTAATTTTATTCATTAATGGTTAAGTTAATTTTATTCATGAATAGTTAAGTAA TGGTAGAAATTATTGTCTTCCTCAGAAGTCAGATAAACAATCTAATTGGGATAAACTAGGTTCTCAGGAAGTGACCTAGA AGTAAGTGGATGAATTAGCAAAGCAGAAATTGCCACGCAGACGCCTCTGTACCAATGCAGGCCTTTTCCAAGGGCACACA ATCTTCTGCCTGCTCTGTCTGGGCCTGTTGGCACTAACCCCGTTTTACTACTTGAGCTTATTTAAAGCCATCCAAGTTTA GGTGAAGTCCCTTGTTGGCTCTCCATGAACTGTGTGTCAATGTTGGCAAAGGGCCCGTGTGTTAAACCCCAAGGGCGCAT ACCCCTGCCGGAAGGCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 894456: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8944561887881AA253532SWMFCA1423SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:24:41 on Mon 20 Nov 117.