EST 894458 is a singleton


Sequence

>894458 (1 EST) Length=657 CAGCAATGACAGAAAAAGGATGAACGATTTGGCACAAGCAAGCGATGATGTACAAGAAGGTTGGATGGCAAGTACAGACT GGGTTGAATCCTGGAAAAGTAAACTTCCTCTTCAAACGGTGATGAGGCTTCTGCAAGTTCTTGTGCCACAGGTTGAGAAG ATTTGCATCGATAAGGGTTTAACAGACGAAAGCGAAATCCTGAAGTTCCTTCAGCATGGTACTTTGGTAGGATTGTTGCC AGTTCCTCATCCTATACTTATTAGAAAATATCAGGCTAACGCTGGTACTAATCACTGGTTTCGAACGTATCTATGGGGAG TCATTTATTTAAGAAATATCGACCCACCAATTTGGTATGATACCAATGTTAAATTGTTCGAAATCCAGAAAACCTAGATT TCTCATCCATTCTTTTAAATTATTTGTTAGAAATGGTTCTGCTGAAAAACTTCCCGTCATTATTTCGTCGATGTTTGAGA AGAAATTGTCTGAGAAAACTTTTTCACATAAAAAAAGAATTGAATAACTGATACCATTTTACATCTGTTGAATTATCTAC TTTACAGTTATCCCTTAATTGTGTTCGTTCAGTTAATTTTATCCCCAACCCTCCTGGTGATTTAGAATGCGTGTTCTTGA GGTGTGCCAACGTTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 894458: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8944581887883AA253534SWMFCA1425SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:15:19 on Thu 23 Nov 117.