EST 894466 is a singleton


Sequence

>894466 (1 EST) Length=665 GGGAAATTCATGTGGAGGTCAGAGTGAAAGCAGGTGTGAGTGGATGCAACGGACAGGATCATGGCTGCCAAAGTGTTTGA GTCCATCGGAAAGTTCGGCCTGGCTTTAGCAGTCGCAGGAGGCGTGGTGAACTCTGCCTTATATAATGTGGATGCTGGGC ACAGAGCTGTCATCTTTGACCGATTCCGTGGAGTGCAGGACATTGTGGTGGGGGAAGGGACTCACTTTCTCATCCCTTGG GTACAGAAACCAATTATCTTCGACTGCCGCTCTCGACCACGGAATGTGCCGGTCATCACTGGGAGCAAAGACTTGCAGAA CGTCAACATCACCCTGCGCATCCTCTTCCGGCCGGTGGCCACCAGCTTCCTCGCATCTACACCAGCATCGGCGAAGACTA CGACGAGCGGGTGCTGCCGTCTATCACCACGGAGATCCTCAAGTCCGTGGTGGCTCGCTTCGATGCTGGGGAACTGATTA CCAGCGAGAGCTGGTCTCCAGGCAGGTGAACGAAGAACTCACAGAGAGAACAGCCACATTTGGGCTCCTCCCTGGATAAC TTTTCCTGACACATCTGAACTTCCGGAAGGATTTCCCGAAACCATGAAACCCAACAGGTGGTCCCCCGGAACCGAAAAGG CAAATTTTTGTTGAAAAGGGAACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 894466: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8944661887891AA253542SWMFCA1437SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:28:11 on Wed 22 Nov 117.