EST 894481 is a singleton


Sequence

>894481 (1 EST) Length=630 GAGATAATGGTTAAGAGGGACGGACGGGGGCATTCGTATCGCTGCGTGAGAGGTGAAATTCTTGGACCGTAGCGAGACGT ACGACTGCGAAAGCATTTGCCAAGAATGTCTTCATTAATCAAGAACGAAAGTCAGAGGTTCGAAGGCGATCAGATACCGC CCTAGTTCTGACCGTAAACGATACCAACTAGCGTTCCGTCGGCGGTAAATACGCCTTGACGGGCAGCTTCCCGGAAACGA AAGTTTTTCGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGAAATTGACGGAAGGGCACCACCAGGAGTGGA GCCTGCGGCTTAATTTGACTCAACACGGGAAAACTCACCTGGCCCGGACACCGTGAAGGATTGAACAATAACAGGTCTGT GGATGCCTTAGATGTCCAGGGCTGCACGCGCCGCTACACTGGAAGAATCAGCCGTGCTGTTACCCATTATCGAAAAGATA TTGGGTAACCCCTTGAAAAATCCCCCCGTGAATCCGGGATCGGGGAATTGCCAATTTATTTCCCCTTGAAACGAAGGAAT TCCCTAATTTAGTTTGTGAAGTTCATCCAGCCTCCACGTTTGAATTTACGTTCCCCTGGCCCCTTTGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 894481: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8944811887906AA253557SWMFCA1605SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:20:53 on Sun 19 Nov 117.