EST 894487 is a singleton


Sequence

>894487 (1 EST) Length=111 TTTAGGTATTTGATTGAAATATTTAAGAGTATTTAAGCTTTCCAGTATATCACAGGTAAATGGGAAATGTGTCTTATAAA TAGAGACGTACTAAAATTATGTTTACATCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 894487: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8944871887912AA253563SWMFCA1725SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:10:45 on Sun 19 Nov 117.