EST 896293 is a singleton


Sequence

>896293 (1 EST) Length=468 CAGAAATACGATGCTATTTTACAATTGCTTATTCTCGCTTGGTACTTTTATAATGGTAATCAATGCTAAGACAAAAAATT CAGCAGATAAATGCAGAGATCTGGATCGACATTGTTCTGATTTAATTGCACAAGATGGAAGTCAGTGTTTGAAATCAGCA TTTGCCANGAAAAATTGTTTAATGACATGTATGATATGTGGTGAAATCGAGAAAAAATATGATGTACGTTATGTACCAGA ATTATTGAAGCCACTAGCCTGGTTAATTGGAATTTGGCGTGCTGAATCTGGTGGCAAAGCAATCTTTCCAACAATACCTG TATTTACATATGGGGAACAAATTGAATTTTCATTGCCAACTTCCACCTTAAAAGCNCTTAAAGCACTTAACTATACAGCT TTTGGCATGGGAATATGAATAANCCTGAAGAANTTGCCATATTGAATATGGGTTTTTATAACCTTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 896293: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8962931889973AA255370SW3ICA2405SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 20:47:27 on Wed 22 Nov 117.