EST 896302 is a singleton


Sequence

>896302 (1 EST) Length=447 GTTTGTGCTCCAGAATCTAAGATTTTCACTTGACTACGATTGTGGTGATTACATAAGATTTTTTTCAGAATATTCTCGGT ACACCTGGTGCAGGTTTTAAAGTAGCAATGGAGGCATTTGATATGACCCGTCCTGCTGTTGCAGCTGCAGCAGTTGGACT TTCTTGGCGTGCTCTCGATGAAGCATGCAAGTATGCATTAGAAAGAAAAGCATTCGGAGTGCCAATTGCTATGGTATTCG TCATGACTCATTGTTCAAAAGTTTCTAAACATTAGTGGTAGTGCAGTTATAGCTGTAATCAAAGGATTAAACTAGTGTTT GCNAACATAGGAAGAGTGTTGATGAGCAAATCTCTCAGAATCTAGTTGTATAATGTTATATATTGCTGTTATAATCTCCT TCCTCTCTTATTTAAATCAGGATACGTTCATTTTGGCAAAATGGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 896302: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8963021889982AA255379SW3ICA2418SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 10:37:53 on Mon 20 Nov 117.