EST 896309 is a singleton


Sequence

>896309 (1 EST) Length=516 CACGNTCCTACNGATTACAGTTCTTCGGATCAATATGAGAAAGTACCATTTCCACTAATTCAACAACAGAAATTGGTACC TCTACCTGAACCACATCTCAATGTACTAATGTCCAATCCACAGGTTTTACCAAATTTATCATCATTTTTCTCTGCTCAAT CAACACCAACCTCTGATAATTTTATTTCCAACTACCTAGCTTATCCAGTACGAAATCAAAATTCAGAAATTAATAAGGAT GATGAAGAGCAGCAAAATCCTTCATCAACTTCACGACGTATAAAAGAACGATCAAAAACATTGAAAGGTGGAGCATTATT TAAACGAATGTCATTTAATCCAAAACTTTGGGAGACAAAACGTGGAAAAGATATGGAATTAATAAGTACACCAACAATTG AAAGTTATCGATGAATGTCAACAAAATGTTTCCNAANAAGTTTTATGAAAAACAGAAAGGAATATCCNCAGATGATAGTG TTTGATATTAAGAAGGAAAAGATCTGATCCGTTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 896309: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8963091889989AA255386SW3ICA2426SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 21:58:53 on Sat 18 Nov 117.