EST 896333 is a singleton


Sequence

>896333 (1 EST) Length=591 CCAGTACATCTTACTGTGAAAGCTGCCGTTGCCTTCTCAGCCGCCAATTCGATCATCACAGCTACTTCCACGAAAAGAAT TCCTATTTAAATCAACACCATTACCAAGAATTATCACTCAACAACAGTTGTCGACAAGAACGTCATTCAGACCTAAAACA AAGACGTCTTTTTTGGTGTCTCGATTGCCTCAGCTTGTGAAACAGCCTCAGCAGCTTCGAACTAACTTGGTTGCACCAAC ATCAACAACAATTTCACCGCATCCTATAGAAACAGTACCGACCATACCGCATGCGCAATCATCACAACCATCTTCACAGA TCGGCCTTCCATCACAATCCCACTCAACTTCCAATTCATTAAGGACAGGAGTTATGTCATGCATCCATTTTCTACATATC TACACCCATGAAAAATCCCAAAAAGCATTCATTTACACATTTTGCTATCACTGTATCAACCGACCAGTGTGCCAGAACTT GCCATGAATTTATTGTGCCATAGCACATTACGACCCGTCCAGGACNTTGCCAGTTCATCCCATCNACAGCATTCGCATGG GTTAAGGGAAATGCCTCCGTGGCCTGCTACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 896333: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8963331890013AA255410SW3ICA2450SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 0:49:30 on Fri 24 Nov 117.