EST 896335 is a singleton


Sequence

>896335 (1 EST) Length=442 ANAGTTTGAGGTTCCAGAATCAAAAATCGNTGCAAATGTCAGTTGCGAAAATTCCGACACCATGCGAATTAAAAAAACTT TTTGGTCAGTCCAATGCAAAAAACAAGGAAATACCATATGATGTTATTGTATGTACACNAAAACTTTGTGCGCGTTATCT CGGTGGTGCATGGAATACAATTAGCCCAGAGCAGTTACGTATGCAACCAGTTATTGGTGGGATAAGCAATTTATTATTCT TGGTGGAACTACCANAAAATGTACTNCCAGAAGGAGGAGAACCGGTTTGTTCACTTTTGCGCATACATTGTNCCGATGAT CTTGATCGTCTTCTCAGTGAAGCAGTTGTTTTTACAATGCTTTCTGAAAGATTGCTTGGACCACGACTNTTTGCTGCTTT TCCATCAGGTCGTTTCGAACAATATCTTCCCCNCGACCATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 896335: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8963351890015AA255412SW3ICA2452SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:20:48 on Sat 18 Nov 117.