EST 898108 is a singleton


Sequence

>898108 (1 EST) Length=425 ACCGGCACGAGTTGAAAACCAGTTGAAGGATTGAAAACTAAAAAGCATATAACCGGAAATATCTACTGCTTCGTAATTCT TATCATCTTATTTTATCATATTCTCTGTTCATATTTGTTTCTCATCATCCCAAGATACTTTGCGGCTCTTATTTTCTTTC AAGTGTTATTCAATCATATTCCGTTGTTTCTATGATTTTTCTGCCACCAAAACGATGAGCTGATGGAGTAACATAAATTC CACGTATGTATTAATAATCTGTGAATGACNTGTCTGGAAGAAGAAACTGCTGATTTGGGACTTTCTATATTCCTATAGTT TGATGACTGTAATTCGTTATAGTTGAATTATTGATTGATCATACGCTCGAACAATGGCTGCTGTTGGTATCGTTCATGCT GAACATCTAACCACGAATTCTGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898108: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8981081892713AA257185SWMFCA1473SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:37:5 on Fri 24 Nov 117.