EST 898117 is a singleton


Sequence

>898117 (1 EST) Length=639 GGATTTAGCTGGCATCGAAGGACGGGTATGTGTGAGAGCAGTTTGCCCGTTGGACACTCAGGCAAGCCACTGAGCAGGTC GAGACAGTGTGAAGTGTATTGCATGGGTACTCCAATTCTTTCTAGAATTTGTTGGGTGGTGTACTGACTGATACATCGAA AAGGTGACGACGCTGTTGAATACTACTAGGTTTCTCTTAGAATCCACAGATTTTATGATAAGCCCCTTTCTGAGGTTACT TTTGATTCACTGTGTCTTATACTTACTGCACTATCACAAGAGGCATAGTGTATTAGTGGAGGGATGACCTACTGCTCTTG AAATTAATATGAATTCATGAAAGTGGATTTGGAATGTTAAATTAGAGAATTTCGGATTTAACTGCGTTGAATGCGTTTGC AATAGTATTCAGAAATTGAGAGCCTCTACAAAGAATATTGTCGAAAGTTACTGTGACCTATGTTATGTGTTCATTGTATT ATAGAATCCCAAATTCATACAGTTGTGTTCTTGGAATACACCTTTCCCATCCCAATAATATTATCTGAATTGTATGCCTT AATTCCGAATATATCCTTAAAATTCCGAATTGCCAAACCAAAACCAAAACCTTTTAATCCGGGTAATCCCACTTAAGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898117: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8981171892722AA257194SWMFCA1485SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:29:25 on Sun 19 Nov 117.