EST 898125 is a singleton


Sequence

>898125 (1 EST) Length=213 AAAAACGGAATTTTGTGTGGGACGAATTGCTGAGAAACTTCATAATCTTCATCACTCATAGGCCACTGAGCTAATTTTGA GAAAATATACCTTTACAAATTAATTAAAAATTCTCAAAAGTATAATCACTGAGCANATTTTAGTGGAAGAAAGATTACAA AGTTTTCTGGTNAATGTCGAACAATTCTAATATTTGATTGTTCAAGAATTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898125: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8981251892730AA257202SWMFCA1493SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:49:9 on Sat 18 Nov 117.