EST 898132 is a singleton


Sequence

>898132 (1 EST) Length=226 TTTTAAATGTATCGCTGTCCTTCATGTGTNCATTTCAGAGTTATCCCACAATTGATGGCACGTTTAGATTCGAAACAAAA TGTCGCTCAGTTAATCAAANAAGTTGTCATCGACTTATCGAAAGTTCACCCACAGTCTTTGGTTTATGCCCTTACAGTGG CTGCGAGNTCGGCTAATTTACGCCGTTCTGCAGTTGCAACAGAGATATTAACGATTATGAGCGACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898132: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8981321892737AA257209SWMFCA1501SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:2:24 on Wed 22 Nov 117.