EST 898138 is a singleton


Sequence

>898138 (1 EST) Length=224 CTTGTCCTGGTCATTCTTGCATGTGGGTCCATTGCCTGCGCAAGGCAGCTCTGTCTCCCCTCAGGCTGCTCTGTTCCTTC TTCCCTGGCATTCTGCCTTCGTGCCTGTGTACCTCACTTCCGGAGACTGAGAAGATGAAGGTACAATTGATGAGCAGACC CTGCCCCAAGCTCCATTTGCAGAAGCCCCCGTGGCCTCAGCACGATGGTTCTTACTTGCCAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 898138: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8981381892743AA257215SWMFCA1513SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 22:13:58 on Fri 17 Nov 117.