EST 898161 is a singleton


Sequence

>898161 (1 EST) Length=566 CAAGTTTGAGGTAGTAAATTTTAAGTGCGCTTTAAAGTAGTCCAAATGTCGGGTCGAGGCAAAGGAGGTAAAGCTAAATC ATCAGCCAAAGCTAAGACACGCTCTAGCAGGGCTGGTCTACAATTTCCCGTTGGTCGAATACATCGGCTTCTTCGCAAGG GAAACTATGCTGAACGTGTTGGCGCTGGTGCTCCAGTGTATCTAGCAGCGGTATTGGAGTATCTTGCCGCAGAAGTGCTC GAATTAGCGGGTAATGCTGCTCGTGATAATAAAAAGAGCCGCATCAATCCTCGTCATCTACAGTTAGCCGTACGTAATGA CGAAGAACTAAACAAACTTCTTTCTGGAGTCACTATCGCTCAAGGTGGTGTGCTGCCCGAAATNATTCCATGGCCTTGGT TTTCCTTNGGGCCCTTTGGGGNCCCCCCCCAAAAAATGCGGTGATAAGAATGAAATATAAGTTCGGGGGAAAATTGAAGA ATTTTATTGAATTCCCTTTTTTAACAAGTGTTTTATTAAAAAATCTTTTTGAAATCCCTGTGCGAACTATTTTACCAAAT TGCTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 898161: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8981611892766AA257238SWMFCA1544SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:33:33 on Fri 17 Nov 117.