EST 898162 is a singleton


Sequence

>898162 (1 EST) Length=578 TCAACCATGACTTCACCCCACTGGAGATCCTCTGGACTTTCTCTATCTACCTGGAGTCGGTGGCCATCTTGCCACAGTTG TTCATGGTAAGCAAGACTGGCGAGGCGGAGACCATCACCAGCCACTACCTGTTTGCCCTGGGGGTCTACCGCACACTTTA TCTCTTCAACTGGATCTGGCGCTACCACTTCGAGGGGTTCTTTGACCTCATCGCCATCGTTGCTGGCCTGGTGCAGACAG TGCTCTACTGCGACTTCTTCTACCTCTATATCACCAAAGTCCTAAAGGGGAAGAAGCTGAGCTTGCCGGCATAGCCCTGG CCTCACTGGCCTTCTCCGAGGCAGGGCAGGAGGCAGAGGAAGGCTGCTGAAGACCGAGAGCCTTCCCATCCAGAGTTGAC TTTTTAAAAGAAGCCTTCAACCCTTCCCCCCCCCCCCNTTTTGGGGGGGGGTCCATCCTCCACTGGTTTGGGGTCATGGA AAAACCCTATCCTGGGGGAACTCAAGAACTGAACTGTTTGTTACCCTTTGCCTTTTAAAAAAGAAAAACCAGAAACCAAT CTTTCCACTAATTTAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 898162: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8981621892767AA257239SWMFCA1545SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:7:36 on Wed 22 Nov 117.